85-6110-30　FXYD domain-containing Ion Transport Regulator 3, Recombinant, Human, aa21-38, His-SUMO-Tag 20ug　584598

特徴

• Associates with and regulates the activity of the sodium/potassium-transporting ATPase (NKA) which transports Na(+) out of the cell and K(+) into the cell. Reduces glutathionylation of the NKA beta-1 subunit ATP1B1, thus reversing glutathionylation-mediated inhibition of ATP1B1. Induces a hyperpolarization-activated chloride current when expressed in Xenopus oocytes.; Decreases the apparent K+ and Na+ affinity of the sodium/potassium-transporting ATPase over a large range of membrane potentials.; Decreases the apparent K+ affinity of the sodium/potassium-transporting ATPase only at slightly negative and positive membrane potentials and increases the apparent Na+ affinity over a large range of membrane potentials.
• Source:Recombinant protein corresponding to aa21-38 from human FXYD domain-containing ion transport regulator 3, fused to 6X His-SUMO-Tag at N-terminal, expressed in E.coli.
• Molecular Weight:~20.5kD
• Amino Acid Sequence:AATGACCTAGAAGATAAAAACAGTCCTTTCTACTATGACTGGCACAGCCTCCAG
• Storage and Stability:May be stored at 4°C for short-term only. Aliquot to avoid repeated freezing and thawing. Store at -20°C. Aliquots are stable for 6 months after receipt at -20°C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap. Further dilutions can be made in assay buffer.